ch2adyBeegorimcdad ch2adyBeegorimcdad

02-06-2016
Mathematics

contestada

What's 7/8 as a decimal?
a. 7.8
b. .875
c. 8.7
d. .78

Respuesta :

02-06-2016

If you would like to write 7/8 as a decimal, you can do this using the following steps:

7/8 = (125*7)/1000 = 875/1000 = 0.875 = .875

The correct result would be b. .875.

Answer Link

Otras preguntas

nikita has to get eye surgery that will cost $915 .She can't afford that right now so the eye center says she can pay $75 now and then $40 per month . How much

60 points! Which network component is used to connect one network to another? Which component delivers the message to the destination computer without broadcast

4. Gloria the grasshopper is working on her hops. She is trying to jump as high and as far as she can. Her best jump so far was 28 cm long, and she reached a h

yooo someone help me!?!?!?!? thanks!!

21. Choose the correct solution and graph for the inequality. (1 point) 2x - 2 < - 12 or 2x + 3 > 7 A. x < - 5 or x > 2 B. x < - 5 or x > 5 C.

Boarding Kennel Problem In a boarding kennel, dogs number 12 more than 2 times the number of cats. If there are 75 animals, how many cats are boarded? Step 1: R

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

THE OUTSIDERS BY SE HINTON NO LINKS PLEASE Ponyboy hates the Socs, but he seems a little jealous of them too. How might the Socs be jealous of the Greasers? Wh

Explain some situations in which you might not want to put the common good above your own interests.

Solve the following inequality. m-2 <-2 OR 4m +3 > 15 3 m < [?] OR m > [ ]