VAc0sta VAc0sta

01-11-2016
Mathematics

contestada

If i was born in 1991 how old would i be. Sorry but i dont feel like doing the math

Respuesta :

TooNashty TooNashty

01-11-2016

Either 24 or 25 depending on the exact date. Since today is October 31, if you were born after that you'd be 24, if you were born before you'd be 25

Answer Link

katebrown1 katebrown1

01-11-2016

2016-1991= 25

You would be 25 years old

Answer Link

Otras preguntas

The montreal school of scholars have drawn together a still-growing framework about the ways in which communication constitutes organization.

For which of the following materials is necessary to stop a beta particle? A. Three feet of concrete B. Three inches of lead C. Thin pieces of wood D. Single s

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

__________ involves a rapid loss that occurs just before death. primary aging pathological aging secondary aging tertiary aging

Which of the following do scientists think will probably cause Earth's next ice age?

circadian rhythm refers to

circadian rhythm refers to

Sugar melts at 367°F. What is the melting point of sugar on the Celsius scale?

The available farmland in Mali is in the northeast. True or false

How many meters are there in 21 feet?