cheyennefrost5 cheyennefrost5

03-11-2021
Mathematics

contestada

Which is greater 668cm or 6686mm

Respuesta :

BablaKanchan BablaKanchan

03-11-2021

Answer:

Cm is longer than mm

Step-by-step explanation:

Answer Link

savannahmcculley2 savannahmcculley2

03-11-2021

Answer:

6686mm

Step-by-step explanation:

668cm=6680mm

So therefor 6686 is greater.

Hope this helps! Have a great day ahead. Tell me if im wrong :) Stay safe <3

Answer Link

Otras preguntas

20% of what number is equal to 2/3 of 90?

Which american colony was established in the 1660s as a haven for quakers?

Today many educators would like math instruction to be more active and engaging instead of based on rote memory of principles and definitions. a. True b. Fals

Which factor played a role in the sudden drop after 1928? A. Lack of demand B. Lack of supply C. Lack of credit D. Lack of income

Write about the formation of Himalayas

What does Thomas Jefferson mean by Certain unalienable rights and the in the excerpt from the Declaration of Independence

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What did Jimmy Carter base his views on foreign-policy?

We had lunch: sandwiches, potato chips, and iced tea. Carolyn and her mother talked mostly about neighbors and the congregation at the Japanese Methodist Church

Which style of art is distinguished by texture oli paint ,solid forms suggested by shape imprecise lines ,and intermingled colors