swatnew121212212121 swatnew121212212121
  • 02-08-2022
  • Mathematics
contestada

A grandfather's age in years is the same as his granddaughter's age is months. Together, they are 91 years old. How old is the grandfather?

Respuesta :

lielhochman lielhochman
  • 04-08-2022

Answer:

Step-by-step explanation:

Answer Link

Otras preguntas

Name a few important body functions that your nervous system controls on its own without you having to think about it much?
the members of an animal community are usually similar in
How many positive odd integers less than 300 can be formed using the digits 0, 1,2,3,4?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Find the product. (7x-2) (x+y)
How do the structures of alveoli and capillaries support the function of gas exchange?
9 students can make a poster in 10 hours. How many students should join them so that they all together can make this poster in 6 hours
Which of the following was a territory the United States took from Spain after the Spanish–American War? A. Puerto Rico B. Hawaii C. Cuba D. A
Which phrase refers to failed businesses? a. "the withered leaves of industrial enterprise" b. "serious curtailment of income" c. "no markets for their produce"
One year ago liz was three times as old as her brother jack. in two years she'll be only twice as old as jack. how old are liz and jack now?