janisbaby011J janisbaby011J
  • 02-03-2017
  • English
contestada

Who wrote Sir Gawain and the Green Knight?

Respuesta :

helpme156
helpme156 helpme156
  • 02-03-2017
I believe the author is anonymous but is referred as the pearl-poet
Answer Link
HaleyHales HaleyHales
  • 02-03-2017
Pearl Poet wrote Sir Gawain and the Green knight
Answer Link

Otras preguntas

Have fun with this probem
Paragraph What led to the creation of the first professionally organized police forces in the United States?
5 sources about Cyber bullying Giving brainliest:)
Solve: (2x + 3)/(x - 3) = 3/5 find the value of x and verify that LHS = RHS ?​
does anyone know the answer
1. What is the net force acting on an object, if both are pushing it in the same direction and each is exerting 25 N of force? 2. What is the net force acting o
in rain myths which conclusion about the madagascan
Decide whether the pair of lines is parallel, perpendicular, or neither. 3x - 6y = -1 and 18x + 9y = -14 Group of answer choices Parallel Perpendicular Neither
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
velocity time graph Pls how do i solve , it seems hard.​